DNA primer design for sex identification of Sumatran tiger body samples

نویسندگان

چکیده

Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports cases illegal trade in animal parts have resulted more and samples being seized. Seized sample from needs to be identified with the help molecular methods ensure profile seized including determination their sex. At level, amelogenin gene amplifications are used determine mammals. Previous studies using primers amplification found that X (AMELX) Y (AMELY) bands male were difficult distinguish due very small differences, 20 base pairs (bp). The difficulty distinguishing these errors detecting female individual Therefore, it was a specific as way avoid this error. purpose study (Panthera tigris sumatrae Pocock, 1929). research carried out descriptive observation AMELX AMELY sequences. results 100% able identify sample. present (F= 5’ TCGGTTAACAATTCCCTGGGC’3 R= 5’AGGCCAAATAGGAGTGTGCT’3) is than previously reported.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Sumatran tiger (Panthera tigris sumatrae): a review of conservation status.

The majority of wild Sumatran tigers are believed to live in 12 Tiger Conservation Landscapes covering approximately 88,000 km(2) . However, the actual distribution of tigers across Sumatra has never been accurately mapped. Over the past 20 years, conservation efforts focused on the Sumatran tigers have increased, but the population continues to decline as a result of several key threats. To id...

متن کامل

Real-Time Primer Design for DNA Chips

The design of PCR or DNA Chip experiments is a time consuming process where bioinformatics is extensively used. The selection of the primers, which are immobilized on the DNA chip, requires a complex algorithm. Based on several parameters an optimized set of primers is automatically detected for a given gene sequence. This paper describes a parallel architecture which performs the optimization ...

متن کامل

investigating the feasibility of a proposed model for geometric design of deployable arch structures

deployable scissor type structures are composed of the so-called scissor-like elements (sles), which are connected to each other at an intermediate point through a pivotal connection and allow them to be folded into a compact bundle for storage or transport. several sles are connected to each other in order to form units with regular polygonal plan views. the sides and radii of the polygons are...

Dual-genome primer design for construction of DNA microarrays

MOTIVATION Microarray experiments using probes covering a whole transcriptome are expensive to initiate, and a major part of the costs derives from synthesizing gene-specific PCR primers or hybridization probes. The high costs may force researchers to limit their studies to a single organism, although comparing gene expression in different species would yield valuable information. RESULTS We ...

متن کامل

PrimeArray: genome-scale primer design for DNA-microarray construction

PrimeArray is a Windows program that computes oligonuceotide primer pairs for genome-scale gene amplification by the Polymerase Chain Reaction (PCR). The program supports the automated extraction of coding sequences (CDS) from various input-file formats and allows highly automated primer pair-optimization.

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Biodiversitas

سال: 2023

ISSN: ['1412-033X', '2085-4722']

DOI: https://doi.org/10.13057/biodiv/d240129